mCerulean3-Bcl2-pEGFP-C1
(Plasmid #177416)

• Purpose: To express mCerulean3 fused to the N-terminus of the Bcl-2 family protein, Bcl-2.
• Depositing Lab: David Andrews
• Publication: Liu et al Elife. 2019 Mar 12;8. pii: 37689. doi: 10.7554/eLife.37689.

Backbone

• Vector backbone: pEGFP-C1
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Bcl-2
• Alt name: CBcl2, CBcl-2, mCerulean3-Bcl-2, mCer3-Bcl2
• Species: H. sapiens (human)
• Entrez Gene: BCL2 (a.k.a. Bcl-2, PPP1R50)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCerulean3 (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: TGACGCAAATGGGCGGTAGG
• 3′ sequencing primer: TCGCCCTTTGACGTTGGAGTCCAC

Resource Information

• Supplemental Documents:
  • mCerulean3-Bcl2-pEGFP-C1.gbk
• A portion of this plasmid was derived from a plasmid made by: Human Bcl2 sequence aligns with Genebank accession # M14745.1, except there is a M156I alteration in the coding sequence. The mutation was in the original clone (Janiak et al., 1994) published in JBC, and has been used to inhibit apoptosis by our group and many others. It has always been our assumption that this mutation is a naturally occurring variant. Our clone has been used in many publications as the plasmid was widely distributed when it was first assembled and published. Janiak F, Leber B, Andrews DW. Assembly of Bcl-2 into microsomal and outer mitochondrial membranes. J Biol Chem. 1994 Apr 1;269(13):9842-9. PMID: 8144576. mCerulean3 sequence received from Mark Rizzo PMID: 21479270.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Transfection of this plasmid will express mCerulean3-fused to the N-terminus of Bcl-2. There is a flexible, 7 aa linker "SGLRSTR", between mCerulean3 and Bcl2.