Skip to main content
Addgene

mCerulean3-BclXL-ActA-s2193
(Plasmid #177411)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177411 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    s2193
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Blasticidin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Bcl-XL-ActA, BclX-acta
  • Alt name
    CBclXL-ActA, CBcl-XL-ActA, mCerulean3-Bcl-XL-ActA, mCer3-BclXL-ActA
  • Species
    H. sapiens (human)
  • Promoter Human ferritin
  • Tag / Fusion Protein
    • mCerulean3 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CCTTGAGTTTTGAGCGGAGCTAA
  • 3′ sequencing primer TTACCCCTCTAGACCTGGAAAG
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    See Pubmed ID: 16928273 for description of chimera Bcl-XL-ActA (aka BclX-acta). mCerulean3 sequence received from Mark Rizzo PMID: 21479270.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Transfection of this plasmid will express mCerulean3-fused to the N-terminus of Bcl-XL-ActA. There is a flexible, 7 aa linker "SGLRSTR", between mCerulean3 and

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mCerulean3-BclXL-ActA-s2193 was a gift from David Andrews (Addgene plasmid # 177411 ; http://n2t.net/addgene:177411 ; RRID:Addgene_177411)
Related items: