Venus-BclXL-ActA-pEGFP-C1
(Plasmid #177410)

• Purpose: To express Venus fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-XL-ActA: Bcl-XL with its membrane binding region swapped for ActA (mitochondrial targeting sequence).
• Depositing Lab: David Andrews
• Publication: David Andrews Lab plasmids (unpublished)

Backbone

• Vector backbone: pEGFP-C1
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Bcl-XL-ActA, BclX-acta
• Alt name: VBclXL-ActA, VBcl-XL-ActA, Venus-Bcl-XL-ActA
• Species: H. sapiens (human)
• Promoter: CMV
• Tag / Fusion Protein:
  • Venus (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: TGACGCAAATGGGCGGTAGG
• 3′ sequencing primer: TCGCCCTTTGACGTTGGAGTCCAC

Resource Information

• Supplemental Documents:
  • Venus-BclXL-ActA-pEGFP-C1
• A portion of this plasmid was derived from a plasmid made by: See Pubmed ID: 16928273 for description of chimera Bcl-XL-ActA (aka BclX-acta). Venus sequence received from Dr. Ray Truant (McMaster University).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Transfection of this plasmid will express Venus-fused to the N-terminus of Bcl-XL-ActA. There is a flexible, 7 aa linker "SGLRSRE", between Venus and BclXL-ActA. This Venus protein contains an F224R mutation to make it monomeric. Note that following the stop codon at the end of the “ActA” sequence, this plasmid contains a ~1000bp insertion in the original pEGFP-C1 backbone that consists partially of duplication of the backbone itself and a sequence left over from cut and paste from another backbone. Expression of the protein of interest, Venus-BclXL-ActA, in BMK and MCF-7 cells was not affected by this insertion.