Skip to main content
Addgene

AAV-CMV-TetRC-2A-Tomato-bGHpA;U6_BsaI-sgRNA
(Plasmid #177365)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177365 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pX602-AAV-TBG__NLS-SaCas9-NLS-HA-OLLAS-bGHpA;U6__BsaI-sgRNA
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 2597
  • Total vector size (bp) 6340
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    tdTomato
  • Species
    Synthetic
  • Promoter CMV
  • Tags / Fusion Proteins
    • P2A (C terminal on insert)
    • a tetracycline-controlled transactivator (tTA) (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gateway Cloning
  • 5′ sequencing primer AGGGTAGGCTGCTCAA
  • 3′ sequencing primer ACAAGGTGAAGATGCGCG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Chimeric guide for SaCas9
  • Species
    Staphylococcus aureus
  • Insert Size (bp)
    101
  • Promoter U6 promoter

Cloning Information for Gene/Insert 2

  • Cloning method Gateway Cloning
  • 5′ sequencing primer tgtaaacacaaagatattagt
  • 3′ sequencing primer ACAAGGTGAAGATGCGCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.21203/rs.3.rs-1065603/v1 for preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-CMV-TetRC-2A-Tomato-bGHpA;U6_BsaI-sgRNA was a gift from Naoki Yamamoto (Addgene plasmid # 177365 ; http://n2t.net/addgene:177365 ; RRID:Addgene_177365)
  • For your References section:

    Engineering of AAV-Mediated in Vivo Targeted DNA Methylation Editing System via Staphylococcus Aureus Derived Cas9-SunTag. Yamamoto N, Morita S, Hatada I, Ideta-Otsuka M, Tamura H, Narita M, Igarashi K. Research Square [Preprint] 2021. doi: 10.21203/rs.3.rs-1065603/v1. 10.21203/rs.3.rs-1065603/v1