AAV-CMV-TetRC-2A-Tomato-bGHpA;U6_BsaI-sgRNA
(Plasmid
#177365)
-
PurposeAAV expression of Chimeric guide for SaCas9 and reverse tetracycline-controlled transactivator for doxycycline controlled expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177365 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX602-AAV-TBG__NLS-SaCas9-NLS-HA-OLLAS-bGHpA;U6__BsaI-sgRNA
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 2597
- Total vector size (bp) 6340
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nametdTomato
-
SpeciesSynthetic
- Promoter CMV
-
Tags
/ Fusion Proteins
- P2A (C terminal on insert)
- a tetracycline-controlled transactivator (tTA) (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gateway Cloning
- 5′ sequencing primer AGGGTAGGCTGCTCAA
- 3′ sequencing primer ACAAGGTGAAGATGCGCG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameChimeric guide for SaCas9
-
SpeciesStaphylococcus aureus
-
Insert Size (bp)101
- Promoter U6 promoter
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer tgtaaacacaaagatattagt
- 3′ sequencing primer ACAAGGTGAAGATGCGCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.21203/rs.3.rs-1065603/v1 for preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-CMV-TetRC-2A-Tomato-bGHpA;U6_BsaI-sgRNA was a gift from Naoki Yamamoto (Addgene plasmid # 177365 ; http://n2t.net/addgene:177365 ; RRID:Addgene_177365) -
For your References section:
Engineering of AAV-Mediated in Vivo Targeted DNA Methylation Editing System via Staphylococcus Aureus Derived Cas9-SunTag. Yamamoto N, Morita S, Hatada I, Ideta-Otsuka M, Tamura H, Narita M, Igarashi K. Research Square [Preprint] 2021. doi: 10.21203/rs.3.rs-1065603/v1. 10.21203/rs.3.rs-1065603/v1