pSN687
(Plasmid
#177363)
-
PurposeExpresses human KIF1A(1-393)(P305L) fused with leucine zipper and His tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177363 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET21a
- Backbone size w/o insert (bp) 5352
- Total vector size (bp) 6672
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameKIF1A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1320
-
Mutationchanged Proline 305 to Leucine
-
Entrez GeneKIF1A (a.k.a. ATSV, C2orf20, HSN2C, MRD9, NESCAVS, SPG30, UNC104)
- Promoter T7
-
Tags
/ Fusion Proteins
- Leucine zipper (C terminal on insert)
- His tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggaattgtgagcggataacaattcc
- 3′ sequencing primer acccctcaagacccgtttagag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSN687 was a gift from Shinsuke Niwa (Addgene plasmid # 177363 ; http://n2t.net/addgene:177363 ; RRID:Addgene_177363) -
For your References section:
De novo mutations in KIF1A-associated neuronal disorder (KAND) dominant-negatively inhibit motor activity and axonal transport of synaptic vesicle precursors. Anazawa Y, Kita T, Iguchi R, Hayashi K, Niwa S. Proc Natl Acad Sci U S A. 2022 Aug 9;119(32):e2113795119. doi: 10.1073/pnas.2113795119. Epub 2022 Aug 2. 10.1073/pnas.2113795119 PubMed 35917346