AAV-TRE-scFVtet1_bGHpA
(Plasmid
#177357)
-
PurposeAAV expression of scFV-fused catalytic domain of TET1 from doxycycine-inducible promoter for targeted DNA methylation editing
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177357 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX603-AAV-CMV_NLS-dSaCas9(D10A,N580A)-NLS-3xHA-bGHpA
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 2597
- Total vector size (bp) 6646
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTet Methylcytosine Dioxygenase 1
-
Alt nameTET1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3769
-
MutationN terminal domain of human Tet1
-
GenBank IDLC169511
-
Entrez GeneTET1 (a.k.a. CXXC6, LCX, bA119F7.1)
- Promoter Tetracycline-dependent promoter
-
Tags
/ Fusion Proteins
- scFV (N terminal on insert)
- myc (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CCAGCTGGCGTAGTTGCTG
- 3′ sequencing primer tgctcacggctcggttttgat (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byscFV and TET1CD was cloned from pCAG-scFvGCN4sfGFPTET1CD which was a gift from Izuho Hatada (Addgene plasmid # 82561 ; http://n2t.net/addgene:82561 ; RRID:Addgene_82561)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.21203/rs.3.rs-1065603/v1 for preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-TRE-scFVtet1_bGHpA was a gift from Naoki Yamamoto (Addgene plasmid # 177357 ; http://n2t.net/addgene:177357 ; RRID:Addgene_177357) -
For your References section:
Engineering of AAV-Mediated in Vivo Targeted DNA Methylation Editing System via Staphylococcus Aureus Derived Cas9-SunTag. Yamamoto N, Morita S, Hatada I, Ideta-Otsuka M, Tamura H, Narita M, Igarashi K. Research Square [Preprint] 2021. doi: 10.21203/rs.3.rs-1065603/v1. 10.21203/rs.3.rs-1065603/v1