Skip to main content
Addgene

AAV-TRE-scFVDnmt3AL_bGHpA
(Plasmid #177354)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177354 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pX603-AAV-CMV_NLS-dSaCas9(D10A,N580A)-NLS-3xHA-bGHpA
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 2597
  • Total vector size (bp) 6152
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    catalytic domain of DNA Methyltransferase 3 Alpha
  • Alt name
    Dnmt3a
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3274
  • Mutation
    598–908 aa of mouse Dnmt3a
  • Entrez Gene
    Dnmt3a (a.k.a. MmuIIIA)
  • Promoter Tetracycline-dependent promoter
  • Tags / Fusion Proteins
    • P2A (N terminal on insert)
    • C-terminal domain of mouse Dnmt3l (194–415 aa) (C terminal on insert)
    • scFV (N terminal on insert)
    • myc (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GCACCCAGCTGGCGTAG
  • 3′ sequencing primer GCCCTTCTTCTGGATATTCATGGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    scFV was cloned from pCAG-scFvGCN4sfGFPTET1CD which was a gift from Izuho Hatada (Addgene plasmid # 82561 ; http://n2t.net/addgene:82561 ; RRID:Addgene_82561)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.21203/rs.3.rs-1065603/v1 for preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-TRE-scFVDnmt3AL_bGHpA was a gift from Naoki Yamamoto (Addgene plasmid # 177354 ; http://n2t.net/addgene:177354 ; RRID:Addgene_177354)
  • For your References section:

    Engineering of AAV-Mediated in Vivo Targeted DNA Methylation Editing System via Staphylococcus Aureus Derived Cas9-SunTag. Yamamoto N, Morita S, Hatada I, Ideta-Otsuka M, Tamura H, Narita M, Igarashi K. Research Square [Preprint] 2021. doi: 10.21203/rs.3.rs-1065603/v1. 10.21203/rs.3.rs-1065603/v1