Skip to main content
Addgene

AAV-CMV-scFVtet1_bGHpA
(Plasmid #177351)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177351 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pX603-AAV-CMV_NLS-dSaCas9(D10A,N580A)-NLS-3xHA-bGHpA
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 2597
  • Total vector size (bp) 6793
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Tet Methylcytosine Dioxygenase 1
  • Alt name
    TET1
  • Species
    H. sapiens (human)
  • Mutation
    N terminal domain of human Tet1
  • GenBank ID
    LC169511
  • Entrez Gene
    TET1 (a.k.a. CXXC6, LCX, bA119F7.1)
  • Promoter CMV promoter
  • Tags / Fusion Proteins
    • scFV (N terminal on insert)
    • myc (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer acttggaaatccccgtgagtcaa
  • 3′ sequencing primer ccccacattgatgagtattggtca
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    scFV and TET1CD was cloned from pCAG-scFvGCN4sfGFPTET1CD which was a gift from Izuho Hatada (Addgene plasmid # 82561 ; http://n2t.net/addgene:82561 ; RRID:Addgene_82561)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.21203/rs.3.rs-1065603/v1 for preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-CMV-scFVtet1_bGHpA was a gift from Naoki Yamamoto (Addgene plasmid # 177351 ; http://n2t.net/addgene:177351 ; RRID:Addgene_177351)
  • For your References section:

    Engineering of AAV-Mediated in Vivo Targeted DNA Methylation Editing System via Staphylococcus Aureus Derived Cas9-SunTag. Yamamoto N, Morita S, Hatada I, Ideta-Otsuka M, Tamura H, Narita M, Igarashi K. Research Square [Preprint] 2021. doi: 10.21203/rs.3.rs-1065603/v1. 10.21203/rs.3.rs-1065603/v1