AAV-CMV-scFVDnmt3L_bGHpA
(Plasmid
#177350)
-
PurposeAAV expression of scFV-fused C terminal domain of Dnmt3l for targeted DNA methylation editing
-
Depositing Lab
-
Sequence Information
-
Sequences (2) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177350 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX603-AAV-CMV_NLS-dSaCas9(D10A,N580A)-NLS-3xHA-bGHpA
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 2597
- Total vector size (bp) 5324
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameC-terminal domain of mouse Dnmt3l
-
Alt nameDnmt3l
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2444
-
Mutation194–415 aa
-
Entrez GeneDnmt3l (a.k.a. D6Ertd14e, ecat7)
- Promoter CMV
-
Tags
/ Fusion Proteins
- myc (N terminal on insert)
- scFV (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer cggagttgttacgacattttggaa
- 3′ sequencing primer ttctggatattcatggacaat (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byscFV was cloned from pCAG-scFvGCN4sfGFPTET1CD which was a gift from Izuho Hatada (Addgene plasmid # 82561 ; http://n2t.net/addgene:82561 ; RRID:Addgene_82561)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.21203/rs.3.rs-1065603/v1 for preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-CMV-scFVDnmt3L_bGHpA was a gift from Naoki Yamamoto (Addgene plasmid # 177350 ; http://n2t.net/addgene:177350 ; RRID:Addgene_177350) -
For your References section:
Engineering of AAV-Mediated in Vivo Targeted DNA Methylation Editing System via Staphylococcus Aureus Derived Cas9-SunTag. Yamamoto N, Morita S, Hatada I, Ideta-Otsuka M, Tamura H, Narita M, Igarashi K. Research Square [Preprint] 2021. doi: 10.21203/rs.3.rs-1065603/v1. 10.21203/rs.3.rs-1065603/v1