Skip to main content
Addgene

AAV-hSyn-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
(Plasmid #177345)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177345 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pX603-AAV-CMV::NLS-dSaCas9(D10A,N580A)-NLS-3xHA-bGHpA
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 2879
  • Total vector size (bp) 7388
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dead hSaCas9
  • Alt name
    dead Cas9 from Staphylococcus aureus
  • Species
    Synthetic; Staphylococcus aureus
  • Insert Size (bp)
    4500
  • Mutation
    D10A, N580A
  • Promoter Synapsin
  • Tags / Fusion Proteins
    • 3x GCN4 peptide (C terminal on insert)
    • 3xHA (C terminal on insert)
    • NLS (C terminal on insert)
    • NLS (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GCGGCAGAGAACTCTTCCTCG
  • 3′ sequencing primer CGACATCACCTACCGCGAGTAC
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    pX603-AAV-CMV::NLS-dSaCas9(D10A,N580A)-NLS-3xHA-bGHpA was a gift from Feng Zhang (Addgene plasmid # 61594 ; http://n2t.net/addgene:61594 ; RRID:Addgene_61594)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.21203/rs.3.rs-1065603/v1 for preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-hSyn-dSaCas9-NLS-3xHA-3xSunTag_bGHpA was a gift from Naoki Yamamoto (Addgene plasmid # 177345 ; http://n2t.net/addgene:177345 ; RRID:Addgene_177345)

  • For your References section:

    Engineering of AAV-Mediated in Vivo Targeted DNA Methylation Editing System via Staphylococcus Aureus Derived Cas9-SunTag. Yamamoto N, Morita S, Hatada I, Ideta-Otsuka M, Tamura H, Narita M, Igarashi K. Research Square [Preprint] 2021. doi: 10.21203/rs.3.rs-1065603/v1. 10.21203/rs.3.rs-1065603/v1
Related items: