AAV-TRE-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
(Plasmid #177344)

• Purpose: AAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequence from doxycycine-inducible promoter
• Depositing Lab: Naoki Yamamoto
• Publication: Yamamoto et al Research Square [Preprint] 2021. doi: 10.21203/rs.3.rs-1065603/v1.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pX603-AAV-CMV::NLS-dSaCas9(D10A,N580A)-NLS-3xHA-bGHpA
• Backbone manufacturer: Addgene
• Backbone size w/o insert (bp): 2879
• Total vector size (bp): 7384
• Vector type: Mammalian Expression, AAV, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dead hSaCas9
• Alt name: dead Cas9 from Staphylococcus aureus
• Species: Synthetic; Staphylococcus aureus
• Insert Size (bp): 4506
• Mutation: D10A, N580A
• Promoter: Tetracycline-dependent promoters
• Tags / Fusion Proteins:
  • 3x GCN4 peptide (C terminal on insert)
  • 3xHA (C terminal on insert)
  • NLS (C terminal on insert)
  • NLS (N terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CGTACCATTCTTTGATGTCCTTCCA
• 3′ sequencing primer: GATCAAGATCAACGGCGA

Resource Information

• Supplemental Documents:
  • AAV-TRE-dSaCas9-NLS-3xHA-3xSunTag_bGHpA.gpk
• A portion of this plasmid was derived from a plasmid made by: pX603-AAV-CMV::NLS-dSaCas9(D10A,N580A)-NLS-3xHA-bGHpA was a gift from Feng Zhang (Addgene plasmid # 61594 ; http://n2t.net/addgene:61594 ; RRID:Addgene_61594)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.21203/rs.3.rs-1065603/v1 for preprint.