pBT009.J1.J306
(Plasmid
#177325)
-
PurposescRNA targeting J3 promoter for activation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177325 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneColE1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameJ306
-
gRNA/shRNA sequenceACGGAGCGTTCTGGACACAA
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBT009.J1.J306 was a gift from James Carothers (Addgene plasmid # 177325 ; http://n2t.net/addgene:177325 ; RRID:Addgene_177325) -
For your References section:
Multi-layer CRISPRa/i circuits for dynamic genetic programs in cell-free and bacterial systems. Tickman BI, Burbano DA, Chavali VP, Kiattisewee C, Fontana J, Khakimzhan A, Noireaux V, Zalatan JG, Carothers JM. Cell Syst. 2021 Nov 17. pii: S2405-4712(21)00419-1. doi: 10.1016/j.cels.2021.10.008. 10.1016/j.cels.2021.10.008 PubMed 34800362