pAAV-hSyn-mCherry-SynaptoZip
(Plasmid
#177318)
-
PurposeAAV expression of the synaptic activity-marker SynaptoZip fused to mCherry driven by human Synapsin promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177318 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4528
- Total vector size (bp) 7246
-
Modifications to backboneSubstitution of the original promoter with hSyn
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry-SynaptoZip
-
Alt nameRedZip
-
Alt nameRZ
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)2718
-
GenBank ID
-
Entrez GeneVamp2 (a.k.a. RATVAMPB, RATVAMPIR, SYB, Syb2)
- Promoter hSyn
-
Tags
/ Fusion Proteins
- mCherry (N terminal on insert)
- Myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CTCAGTTCATGTACGGCTCCAAG
- 3′ sequencing primer ATTGGTTAAATCCAAGGGAAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-mCherry-SynaptoZip was a gift from Antonio Malgaroli (Addgene plasmid # 177318 ; http://n2t.net/addgene:177318 ; RRID:Addgene_177318) -
For your References section:
Occlusion of dopamine-dependent synaptic plasticity in the prefrontal cortex mediates the expression of depressive-like behavior and is modulated by ketamine. Lamanna J, Isotti F, Ferro M, Spadini S, Racchetti G, Musazzi L, Malgaroli A. Sci Rep. 2022 Jun 30;12(1):11055. doi: 10.1038/s41598-022-14694-w. 10.1038/s41598-022-14694-w PubMed 35773275