Skip to main content
Addgene

pLenti-hPGK-mCherry-SynaptoZip
(Plasmid #177317)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177317 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLenti
  • Backbone manufacturer
    L Naldini
  • Backbone size w/o insert (bp) 7079
  • Total vector size (bp) 9803
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry-SynaptoZip
  • Alt name
    RedZip
  • Alt name
    RZ
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    2718
  • GenBank ID
  • Entrez Gene
    Vamp2 (a.k.a. RATVAMPB, RATVAMPIR, SYB, Syb2)
  • Tags / Fusion Proteins
    • mCherry (N terminal on insert)
    • Myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CTCAGTTCATGTACGGCTCCAAG
  • 3′ sequencing primer ATTGGTTAAATCCAAGGGAAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-hPGK-mCherry-SynaptoZip was a gift from Antonio Malgaroli (Addgene plasmid # 177317 ; http://n2t.net/addgene:177317 ; RRID:Addgene_177317)
  • For your References section:

    Occlusion of dopamine-dependent synaptic plasticity in the prefrontal cortex mediates the expression of depressive-like behavior and is modulated by ketamine. Lamanna J, Isotti F, Ferro M, Spadini S, Racchetti G, Musazzi L, Malgaroli A. Sci Rep. 2022 Jun 30;12(1):11055. doi: 10.1038/s41598-022-14694-w. 10.1038/s41598-022-14694-w PubMed 35773275