pYTSK01K_0G7
(Plasmid #177296)

• Purpose: genomic integration of genes (inserted in I-SceI-site) via transposon Tn7 with GmR
• Depositing Lab: Karl-Erich Jaeger
• Publication: Tiso et al Front Bioeng Biotechnol. 2020 Aug 20;8:976. doi: 10.3389/fbioe.2020.00976. eCollection 2020.

Backbone

• Vector backbone: yTREX backbone
• Backbone size w/o insert (bp): 14684
• Vector type: Bacterial Expression, Synthetic Biology ; Yeast Expression, Tn7 genomic integration
• Selectable markers: Gentamicin ; URA3

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: PaacC1-aacC1
• Alt name: gentamicin resistance module - GmR
• Alt name: Gentamicin 3-N-acetyltransferase
• Species: Pseudomonas aeruginosa
• Insert Size (bp): 752

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TACGACTACGCGTCCATGGC
• 3′ sequencing primer: GCCAAATTGCGTCAAGATCC

Resource Information

• Supplemental Documents:
  • pYTSK01K_0G7.gbk
• A portion of this plasmid was derived from a plasmid made by: Kyoung-Hee Choi et al (pUC18-mini-GM in PMID: 15908923)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Part of the pYT vector series which facilitates chromosomal integration in attTn7-site with selection on gentamicin. Target expression cassettes can be inserted at the I-SceI site.