Skip to main content
Addgene

pYTSK01K_0G7
(Plasmid #177296)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177296 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    yTREX backbone
  • Backbone size w/o insert (bp) 14684
  • Vector type
    Bacterial Expression, Synthetic Biology ; Yeast Expression, Tn7 genomic integration
  • Selectable markers
    Gentamicin ; URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    PaacC1-aacC1
  • Alt name
    gentamicin resistance module - GmR
  • Alt name
    Gentamicin 3-N-acetyltransferase
  • Species
    Pseudomonas aeruginosa
  • Insert Size (bp)
    752

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TACGACTACGCGTCCATGGC
  • 3′ sequencing primer GCCAAATTGCGTCAAGATCC
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Kyoung-Hee Choi et al (pUC18-mini-GM in PMID: 15908923)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Part of the pYT vector series which facilitates chromosomal integration in attTn7-site with selection on gentamicin. Target expression cassettes can be inserted at the I-SceI site.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYTSK01K_0G7 was a gift from Karl-Erich Jaeger (Addgene plasmid # 177296 ; http://n2t.net/addgene:177296 ; RRID:Addgene_177296)

  • For your References section:

    Integration of Genetic and Process Engineering for Optimized Rhamnolipid Production Using Pseudomonas putida. Tiso T, Ihling N, Kubicki S, Biselli A, Schonhoff A, Bator I, Thies S, Karmainski T, Kruth S, Willenbrink AL, Loeschcke A, Zapp P, Jupke A, Jaeger KE, Buchs J, Blank LM. Front Bioeng Biotechnol. 2020 Aug 20;8:976. doi: 10.3389/fbioe.2020.00976. eCollection 2020. 10.3389/fbioe.2020.00976 PubMed 32974309
Related items: