Skip to main content
Addgene

pEDJ506
(Plasmid #177274)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177274 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCfB2909
  • Backbone size w/o insert (bp) 4500
  • Total vector size (bp) 6455
  • Vector type
    Bacterial Expression, Yeast Expression
  • Selectable markers
    None

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ADH1t:HIS3_23∆29-XII-5 :<-PGK1p
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1888
  • Promoter PGK1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sfa.AI (destroyed during cloning)
  • 3′ cloning site Sfa.AI (destroyed during cloning)
  • 5′ sequencing primer GTGGTTTAGTTTAGTAGAACC
  • 3′ sequencing primer CTCCTTCCTTTTCGGTTAGAG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Integrative plasmid

Please note: Plasmid contains a 68bp insertion in mADH1t compared to the depositor's provided sequence. This insertion is not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEDJ506 was a gift from Michael Jensen (Addgene plasmid # 177274 ; http://n2t.net/addgene:177274 ; RRID:Addgene_177274)

  • For your References section:

    A synthetic RNA-mediated evolution system in yeast. Jensen ED, Laloux M, Lehka BJ, Pedersen LE, Jakociunas T, Jensen MK, Keasling JD. Nucleic Acids Res. 2021 Sep 7;49(15):e88. doi: 10.1093/nar/gkab472. 10.1093/nar/gkab472 PubMed 34107026
Related items: