pAAV-hSyn-FRISZ-GPI
(Plasmid #177264)

• Purpose: AAV transfer plasmid for cell-surface-localized FRISZ (via CD59 GPI) under hSyn promoter
• Depositing Lab: Huiwang Ai
• Publication: Wu et al Sci Adv. 2023 Mar;9(9):eadd2058. doi: 10.1126/sciadv.add2058. Epub 2023 Mar 1.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV-hSyn
• Backbone size w/o insert (bp): 4280
• Total vector size (bp): 5338
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: CD59 leader-FRISZ-GPI
• Species: Synthetic
• Insert Size (bp): 1059
• Promoter: hSyn
• Tags / Fusion Proteins:
  • CD59 leader sequence (N terminal on insert)
  • CD59 GPI (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCT CAG TCT GCG GTG GG
• 3′ sequencing primer: gttaagaataccagtcaatctttca

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The N-terminal CD59 sequence is for targeting the synthesized peptide to the secretory pathway. The C-terminal GPI transmembrane domain is for anchoring the protein to the mammalian cell surface.
AAV derived from this plasmid has not yet been tested in vivo. We deposit another plasmid, pAAV-hSyn-FRISZ-TM (Addgene # 176886, tested in vivo), which uses an Ig kappa leader sequence for secretory pathway targeting and a PDGFR transmembrane domain for anchoring. We plan to systematically compare various exporting and anchoring strategies.

Please visit https://www.biorxiv.org/content/10.1101/2022.06.02.494512v1 for bioRxiv preprint.