Skip to main content
Addgene

pAAV-hSyn-FRISZ-GPI
(Plasmid #177264)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177264 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV-hSyn
  • Backbone size w/o insert (bp) 4280
  • Total vector size (bp) 5338
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CD59 leader-FRISZ-GPI
  • Species
    Synthetic
  • Insert Size (bp)
    1059
  • Promoter hSyn
  • Tags / Fusion Proteins
    • CD59 leader sequence (N terminal on insert)
    • CD59 GPI (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCT CAG TCT GCG GTG GG
  • 3′ sequencing primer gttaagaataccagtcaatctttca
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The N-terminal CD59 sequence is for targeting the synthesized peptide to the secretory pathway. The C-terminal GPI transmembrane domain is for anchoring the protein to the mammalian cell surface.
AAV derived from this plasmid has not yet been tested in vivo. We deposit another plasmid, pAAV-hSyn-FRISZ-TM (Addgene # 176886, tested in vivo), which uses an Ig kappa leader sequence for secretory pathway targeting and a PDGFR transmembrane domain for anchoring. We plan to systematically compare various exporting and anchoring strategies.

Please visit https://www.biorxiv.org/content/10.1101/2022.06.02.494512v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-FRISZ-GPI was a gift from Huiwang Ai (Addgene plasmid # 177264 ; http://n2t.net/addgene:177264 ; RRID:Addgene_177264)

  • For your References section:

    A genetically encoded far-red fluorescent indicator for imaging synaptically released Zn(2). Wu T, Kumar M, Zhang J, Zhao S, Drobizhev M, McCollum M, Anderson CT, Wang Y, Pokorny A, Tian X, Zhang Y, Tzounopoulos T, Ai HW. Sci Adv. 2023 Mar;9(9):eadd2058. doi: 10.1126/sciadv.add2058. Epub 2023 Mar 1. 10.1126/sciadv.add2058 PubMed 36857451
Related items: