pACE-Truncated-Kir3.2-StreptagII
(Plasmid #177263)

• Purpose: Expresses a truncated from of human Kir3.2 with a C-terminal streptagII in insect cells
• Depositing Lab: Arthur Laganowsky
• Publication: Qiao et al J Phys Chem Lett. 2021 Dec 30;12(51):12218-12224. doi: 10.1021/acs.jpclett.1c03750. Epub 2021 Dec 20.

Backbone

• Vector backbone: pACEBac1
• Backbone manufacturer: Geneva Biotech
• Total vector size (bp): 3714
• Vector type: Insect Expression
• Selectable markers: Gentamicin

Growth in Bacteria

• Bacterial Resistance(s): Gentamicin, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: G-protein-gated inward rectifying potassium channel 2
• Alt name: GIRK2
• Alt name: Kir3.2
• Species: H. sapiens (human)
• Mutation: Residues 49-378
• Entrez Gene: KCNJ6 (a.k.a. BIR1, GIRK-2, GIRK2, KATP-2, KATP2, KCNJ7, KIR3.2, KPLBS, hiGIRK2)
• Promoter: polyhedrin promoter
• Tag / Fusion Protein:
  • StreptagII (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gatcatggagataattaaaatgataaccatctcgc
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC

Resource Information

• Supplemental Documents:
  • pACE-TrHs_kir3.2-StII2-for-snapgene.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry