pLentiCRISPRv2-dADAM17 (#1)
(Plasmid
#177259)
-
PurposeA knockout vector for the dog Adam17
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177259 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneLentiCRISPRv2puro
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameA gRNA targeting the dog Adam17 gene and the cDNA of CRISPR-Cas9
-
gRNA/shRNA sequenceGTGGAGTGCAGTGACAGACA
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCRISPRv2-dADAM17 (#1) was a gift from Michiyuki Matsuda (Addgene plasmid # 177259 ; http://n2t.net/addgene:177259 ; RRID:Addgene_177259) -
For your References section:
Redundant roles of EGFR ligands in the ERK activation waves during collective cell migration. Lin S, Hirayama D, Maryu G, Matsuda K, Hino N, Deguchi E, Aoki K, Iwamoto R, Terai K, Matsuda M. Life Sci Alliance. 2021 Oct 19;5(1). pii: 5/1/e202101206. doi: 10.26508/lsa.202101206. Print 2022 Jan. 10.26508/lsa.202101206 PubMed 34667080