pBAD-tdTEVDB_C-15A/G4C
(Plasmid #177205)

• Purpose: Permuted td intron with evolved initiation sequence for the expression of circular mRNA
• Depositing Lab: Stephen Fried
• Publication: Lee et al ACS Cent Sci. 2021 Oct 27;7(10):1736-1750. doi: 10.1021/acscentsci.1c00574. Epub 2021 Sep 24.

Backbone

• Vector backbone: pBAD
• Backbone size w/o insert (bp): 3912
• Total vector size (bp): 4999
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Tetracycline, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: 20 mM Mg2+ for optimal protein expression
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Permuted GFP with evolved initiation sequence for circular mRNA
• Species: Synthetic; Aequorea victoria
• Insert Size (bp): 1163
• Mutation: Permuted sfGFP after residue 52 & Changed Cytosine -15 to Adenine and Guanine 4 to Cytosine in the initiation sequence
• GenBank ID: GenBank: AKC96462.1
• Promoter: araBAD
• Tag / Fusion Protein:
  • 6x His

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: 5' ACTCTCTACTGTTTCTCCATACCC 3'
• 3′ sequencing primer: 5' CCTTTCGTTTTATTTGATGCCTGG 3'

Resource Information

• Supplemental Documents:
  • pBAD-tdTEVDB_C-15A_G4C.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry