-
PurposeExpresses recombinant HyPro enzyme in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177190 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET28a
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHyPro enzyme
-
Alt nameAPEX2 - DIG10.3 fusion protein
-
SpeciesSynthetic
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
E. coli codon-optimized versions of APEX2 and DIG10.3 genes from https://pubmed.ncbi.nlm.nih.gov/25419960/ and https://pubmed.ncbi.nlm.nih.gov/24005320/, respectively, were fused in frame via the (GGGGS)3 linker sequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pML433 was a gift from Eugene Makeyev (Addgene plasmid # 177190 ; http://n2t.net/addgene:177190 ; RRID:Addgene_177190) -
For your References section:
Hybridization-proximity labeling reveals spatially ordered interactions of nuclear RNA compartments. Yap K, Chung TH, Makeyev EV. Mol Cell. 2021 Nov 2. pii: S1097-2765(21)00838-8. doi: 10.1016/j.molcel.2021.10.009. 10.1016/j.molcel.2021.10.009 PubMed 34741808