pDAS12342_PEAR-GFP_2in1
(Plasmid #177184)

• Purpose: PEAR-GFP plasmid with a pegRNA that targets its own plasmid
• Depositing Lab: Ervin Welker
• Publication: Simon et al Elife. 2022 Feb 23;11. pii: 69504. doi: 10.7554/eLife.69504.

Backbone

• Vector backbone: pUC19
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: EGFP split with an intron between amino acids 95-96
• Species: Synthetic
• Mutation: disrupted 5' splice site
• Promoter: CMV

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: ATGGTGAGCAAGGGCGAGG

Gene/Insert 2

• Gene/Insert name: pegRNA targeting its own plasmid
• Species: Synthetic; S. pyogenes
• Promoter: U6

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: GAGGGCCTATTTCCCATGATT

Resource Information

• Supplemental Documents:
  • pDAS12342_PEAR-GFP_2in1.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Read the preprint at bioRxiv: https://www.biorxiv.org/content/10.1101/2021.04.26.441486v1.