Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLentiGuide-PolB1-puro
(Plasmid #177146)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177146 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Lentivirus
  • Backbone manufacturer
    Addgene
  • Total vector size (bp) 8323
  • Modifications to backbone
    pLentiCRISPRguide
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PolBgRNA1
  • gRNA/shRNA sequence
    GAGCAAACGGAAGGCGCCG
  • Species
    H. sapiens (human)
  • Entrez Gene
    POLB
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (unknown if destroyed)
  • 3′ cloning site BsmBI (unknown if destroyed)
  • 5′ sequencing primer CACCGGAGCAAACGGAAGGCGCCGC
  • 3′ sequencing primer AAACGCGGCGCCTTCCGTTTGCTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiGuide-PolB1-puro was a gift from Robert Sobol (Addgene plasmid # 177146 ; http://n2t.net/addgene:177146 ; RRID:Addgene_177146)
  • For your References section:

    Stability and sub-cellular localization of DNA polymerase beta is regulated by interactions with NQO1 and XRCC1 in response to oxidative stress. Fang Q, Andrews J, Sharma N, Wilk A, Clark J, Slyskova J, Koczor CA, Lans H, Prakash A, Sobol RW. Nucleic Acids Res. 2019 Jul 9;47(12):6269-6286. doi: 10.1093/nar/gkz293. 10.1093/nar/gkz293 PubMed 31287140