Skip to main content
Addgene

pEPQD2KN0895
(Plasmid #177091)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177091 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pICSL4723
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CrSTR, Cr7-DLH, CrLAMT, CrTDC, and CrSLS
  • Alt name
    L2 4X opattB late iridiod cytosol v2
  • Species
    Other

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer GTGGTGTAAACAAATTGACGC
  • 3′ sequencing primer GGATAAACCTTTTCACGCCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

L2 4X opattB late iridiod cytosol v2: P1_4X opattB-TMV- CrSTR-35Sterm + P2_4X opattB-TMV-Cr7DLH-masterm + P3_4X opattB-TMV-CrLAMT-ocsterm + P4_4X opattB-TMV-CrTDC-g7term + P5_4X opattB-TMV-CrSLS-nosterm

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEPQD2KN0895 was a gift from Nicola Patron (Addgene plasmid # 177091 ; http://n2t.net/addgene:177091 ; RRID:Addgene_177091)
  • For your References section:

    Reconstitution of monoterpene indole alkaloid biosynthesis in genome engineered Nicotiana benthamiana. Dudley QM, Jo S, Guerrero DAS, Chhetry M, Smedley MA, Harwood WA, Sherden NH, O'Connor SE, Caputi L, Patron NJ. Commun Biol. 2022 Sep 10;5(1):949. doi: 10.1038/s42003-022-03904-w. 10.1038/s42003-022-03904-w PubMed 36088516