pEPQD1CB0120
(Plasmid
#177052)
-
PurposeMoClo Level 1, position 1, transcriptional unit for transient expression of major latex protein-like (NmMLPL) from Nepeta mussinii driven by 35S promoter; contains a chloroplast transit peptide
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177052 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepICH47732
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemajor latex protein-like (NmMLPL) from Nepeta mussinii
-
Alt nameP1 _35SshortTMV-cTP_NmMLP-35Sterm
-
SpeciesOther
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer CTGGTGGCAGGATATATTGTGGTG
- 3′ sequencing primer GAACCCTGTGGTTGGCATGCACATAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEPQD1CB0120 was a gift from Nicola Patron (Addgene plasmid # 177052 ; http://n2t.net/addgene:177052 ; RRID:Addgene_177052) -
For your References section:
Reconstitution of monoterpene indole alkaloid biosynthesis in genome engineered Nicotiana benthamiana. Dudley QM, Jo S, Guerrero DAS, Chhetry M, Smedley MA, Harwood WA, Sherden NH, O'Connor SE, Caputi L, Patron NJ. Commun Biol. 2022 Sep 10;5(1):949. doi: 10.1038/s42003-022-03904-w. 10.1038/s42003-022-03904-w PubMed 36088516