pEPQD0CM0068
(Plasmid #177025)

• Purpose: Level 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTT
• Depositing Lab: Nicola Patron
• Publication: Dudley et al Commun Biol. 2022 Sep 10;5(1):949. doi: 10.1038/s42003-022-03904-w.

Backbone

• Vector backbone: pUAP1
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: major latex protein-like
• Species: Nepeta mussinii (aka Nepeta racemosa)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: GGCGTATCACGAGGCAGAATTTC
• 3′ sequencing primer: CCTGCATAACGCGAAGTAATC

Resource Information

• Supplemental Documents:
  • pEPQD0CM0068.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Genbank accession: MT108267.1, the CDS sequence has been domesticated (all endogenous BpiI, BsaI, BsmBI and SapI recognition sites removed) and are flanked by an inverted pair of BsaI recognition sites that produce overhangs compatible with the phytobrick assembly standard