pEPQD0CM0060
(Plasmid
#177024)
-
PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTT
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177024 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUAP1
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameiridoid synthase
-
SpeciesCatharanthus roseus (Madagascar periwinkle)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer GGCGTATCACGAGGCAGAATTTC
- 3′ sequencing primer CCTGCATAACGCGAAGTAATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Genbank accession: JX974564, the CDS sequence has been domesticated (all endogenous BpiI, BsaI, BsmBI and SapI recognition sites removed) and are flanked by an inverted pair of BsaI recognition sites that produce overhangs compatible with the phytobrick assembly standard
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEPQD0CM0060 was a gift from Nicola Patron (Addgene plasmid # 177024 ; http://n2t.net/addgene:177024 ; RRID:Addgene_177024) -
For your References section:
Reconstitution of monoterpene indole alkaloid biosynthesis in genome engineered Nicotiana benthamiana. Dudley QM, Jo S, Guerrero DAS, Chhetry M, Smedley MA, Harwood WA, Sherden NH, O'Connor SE, Caputi L, Patron NJ. Commun Biol. 2022 Sep 10;5(1):949. doi: 10.1038/s42003-022-03904-w. 10.1038/s42003-022-03904-w PubMed 36088516