pRN3P_T3_BE3_IVT
(Plasmid
#177015)
-
PurposePlasmid to be used as DNA template for in-vitro RNA transcription of the BE3 base editor (C to T) by T3 RNA polymerase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177015 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRN3P
-
Backbone manufacturerTorres-Padilla et al., 2007
- Backbone size w/o insert (bp) 3091
- Total vector size (bp) 8351
-
Vector typeCRISPR ; Vector for in-vitro transcription
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsGrow solid and liquid cultures always at 30°C
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBE3
-
Alt nameCytosine Base Editor
-
SpeciesSynthetic
-
Insert Size (bp)5260
- Promoter T3 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamhI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer atgagctcagagactggcccag
- 3′ sequencing primer ttagactttcctcttcttcttg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRN3P_T3_BE3_IVT was a gift from Timo Otonkoski (Addgene plasmid # 177015 ; http://n2t.net/addgene:177015 ; RRID:Addgene_177015) -
For your References section:
Simultaneous high-efficiency base editing and reprogramming of patient fibroblasts. Jalil S, Keskinen T, Maldonado R, Sokka J, Trokovic R, Otonkoski T, Wartiovaara K. Stem Cell Reports. 2021 Nov 16. pii: S2213-6711(21)00552-X. doi: 10.1016/j.stemcr.2021.10.017. 10.1016/j.stemcr.2021.10.017 PubMed 34822772