Addgene: pLenti-NG-PE2-BSD Skip to main content
Addgene

pLenti-NG-PE2-BSD
(Plasmid #176933)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176933 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLenti-PE2-BSD
  • Total vector size (bp) 15147
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PE2-NG variant
  • Species
    Synthetic
  • Insert Size (bp)
    6273
  • Promoter EFS
  • Tags / Fusion Proteins
    • SV40 NLS (N terminal on insert)
    • SV40 NLS (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer acacaggaccggttctaga
  • 3′ sequencing primer tccaggattctcttcgacatct
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-NG-PE2-BSD was a gift from Hyongbum Kim (Addgene plasmid # 176933 ; http://n2t.net/addgene:176933 ; RRID:Addgene_176933)
  • For your References section:

    Application of prime editing to the correction of mutations and phenotypes in adult mice with liver and eye diseases. Jang H, Jo DH, Cho CS, Shin JH, Seo JH, Yu G, Gopalappa R, Kim D, Cho SR, Kim JH, Kim HH. Nat Biomed Eng. 2021 Aug 26. pii: 10.1038/s41551-021-00788-9. doi: 10.1038/s41551-021-00788-9. 10.1038/s41551-021-00788-9 PubMed 34446856