pDisplay-FRISZ
(Plasmid #176887)

• Purpose: Far-red fluorescent zinc indicator FRISZ in pDisplay
• Depositing Lab: Huiwang Ai
• Publication: Wu et al Sci Adv. 2023 Mar;9(9):eadd2058. doi: 10.1126/sciadv.add2058. Epub 2023 Mar 1.

Backbone

• Vector backbone: pDisplay
• Backbone size w/o insert (bp): 828
• Total vector size (bp): 6091
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: FRISZ
• Species: Synthetic
• Insert Size (bp): 828
• GenBank ID:
• Promoter: CMV
• Tag / Fusion Protein:
  • pDisplay backbone elements for export and membrane anchor

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: taatacgactcactataggg
• 3′ sequencing primer: tagaaggcacagtcgagg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

When selecting zinc biosensors for your particular application, please pay attention to the Kd. The Kd of the sensor has to match the concentration range of your particular experiments.

Please note: The plasmid contains a LD amino acid insertion before amino acid 158 and a Q158E mutation in the NeoR/KanR. The plasmid also contains a 7 bp deletion in the SV40 promoter. These differences are not known to affect plasmid function.

Please visit https://www.biorxiv.org/content/10.1101/2022.06.02.494512v1 for bioRxiv preprint.