pAAV-hSyn-FRISZ-TM
(Plasmid #176886)

• Purpose: AAV transfer plasmid for cell-surface-localized FRISZ (via PDGFR TM) under hSyn promoter
• Depositing Lab: Huiwang Ai
• Publication: Wu et al Sci Adv. 2023 Mar;9(9):eadd2058. doi: 10.1126/sciadv.add2058. Epub 2023 Mar 1.

Backbone

• Vector backbone: pAAV-hSyn
• Backbone size w/o insert (bp): 4280
• Total vector size (bp): 5365
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Ig kappa-FRISZ-PDGFR TM
• Species: Synthetic
• Insert Size (bp): 1086
• Promoter: hSyn

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: cctcagtctgcggtggg
• 3′ sequencing primer: ccagtcaatctttcacaaattttgtaa

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The N-terminal Ig kappa leader sequence is for targeting the synthesized peptide to the secretory pathway. The C-terminal PDGFR transmembrane domain is for anchoring the protein to the mammalian cell surface. AAV derived from this plasmid has been successfully used for wide-field in vivo imaging. We deposit another plasmid, pAAV-hSyn-FRISZ-GPI (Addgene # 177264, not yet tested in vivo), which uses a CD59 leader sequence for secretory pathway targeting and a CD59 GPI for anchoring. We plan to systematically compare various exporting and anchoring strategies.

Please visit https://www.biorxiv.org/content/10.1101/2022.06.02.494512v1 for bioRxiv preprint.