Skip to main content
Addgene

pLKO-Tet-On-YAP1-shRNA2
(Plasmid #176847)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176847 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Tet-pLKO-Puro (pLKO-Tet-On)
  • Backbone manufacturer
    Dmitri Wiederschain (Addgene plasmid # 21915)
  • Backbone size w/o insert (bp) 8768
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    YAP1-Sh2
  • gRNA/shRNA sequence
    GCCACCAAGCTAGATAAAGAACTCGAGTTCTTTATCTAGCTTGGTGGC
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    48
  • Entrez Gene
    YAP1 (a.k.a. COB1, YAP, YAP-1, YAP2, YAP65, YKI)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer SHSEQ2 GGAAATCACCATAAACGTGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-Tet-On-YAP1-shRNA2 was a gift from Roland Friedel (Addgene plasmid # 176847 ; http://n2t.net/addgene:176847 ; RRID:Addgene_176847)
  • For your References section:

    Plexin-B2 orchestrates collective stem cell dynamics via actomyosin contractility, cytoskeletal tension and adhesion. Junqueira Alves C, Dariolli R, Haydak J, Kang S, Hannah T, Wiener RJ, DeFronzo S, Tejero R, Gusella GL, Ramakrishnan A, Alves Dias R, Wojcinski A, Kesari S, Shen L, Sobie EA, Rodrigues Furtado de Mendonca JP, Azeloglu EU, Zou H, Friedel RH. Nat Commun. 2021 Oct 14;12(1):6019. doi: 10.1038/s41467-021-26296-7. 10.1038/s41467-021-26296-7 PubMed 34650052