pRiboI-APEX2m
(Plasmid #176843)

• Purpose: Expression of APEX2 from a codon-optimized gene (single-copy integrating plasmid)
• Depositing Lab: Jessica Seeliger
• Publication: Ahamed et al Methods Enzymol. 2022;664:267-289. doi: 10.1016/bs.mie.2021.11.021. Epub 2021 Dec 30.

Backbone

• Vector backbone: pMV306
• Backbone manufacturer: Jeffery Cox Lab
• Backbone size w/o insert (bp): 3981
• Total vector size (bp): 4961
• Vector type: Bacterial Expression ; Integrating

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: In mycobacteria use 2mM theophilline to induce gene expression
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: pRibo-APEX2m
• Alt name: pRibo aka.; hsp60 based theophylline (on) riboswitch promotor
• Alt name: Apex2m aka. ascorbate peroxidase 2 (mycobacterial codon optimized)
• Species: mycobacteria
• Insert Size (bp): 1144
• Promoter: pRibo, theophilline riboswitch inducible hsp60 promoter

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GCCTTTGAGTGAGCTGATACC
• 3′ sequencing primer: GATGGCATAAAACGAAAGGCC

Resource Information

• Supplemental Documents:
  • pRiboI-APEX2m plasmid.gb
• A portion of this plasmid was derived from a plasmid made by: Apex2 from Alice Ting was codon optimized for mycobacteria and ordered from genewiz.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: Plasmid contains an E151V mutation in the int feature. This mutation is not known to affect plasmid function.