pRibo-APEX2m
(Plasmid #176842)

• Purpose: Expression of APEX2 from a codon-optimized gene (multi-copy episomal plasmid)
• Depositing Lab: Jessica Seeliger
• Publication: Ahamed et al Methods Enzymol. 2022;664:267-289. doi: 10.1016/bs.mie.2021.11.021. Epub 2021 Dec 30.

Backbone

• Vector backbone: pMV261
• Backbone manufacturer: Jeffery Cox Lab
• Backbone size w/o insert (bp): 4487
• Total vector size (bp): 5077
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: In mycobacteria use 2mM Theophylline for bacterial expression.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: pRibo-APEX2m
• Alt name: pRibo aka.; hsp60 based theophylline (on) riboswitch promotor
• Alt name: APEX2m aka.; ascorbate peroxidase 2 (codon optimized for mycobacteria)
• Species: mycobacteria
• Insert Size (bp): 1040
• Promoter: pRibo, theophilline riboswitch inducible hsp60 promoter

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CGTTGTAGTGCTTGTGGTGG
• 3′ sequencing primer: CTAGCTGATCACCGCGGCCATGATGGC

Resource Information

• Supplemental Documents:
  • pRibo-APEX2m plasmid.gb
• A portion of this plasmid was derived from a plasmid made by: Apex2 sequence from Alice Ting was codon optimized for mycobacteria and ordered from Genewiz for cloning.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry