Skip to main content
Addgene

DOX_SAM_CRISPR-activation-2A-GFP-AAVS1-targeting-construct
(Plasmid #176836)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176836 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAVS1
  • Vector type
    Unspecified

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9-VP64-2A-MS2-p65-HSF1-2A-GFP
  • Species
    H. sapiens (human), Synthetic
  • Mutation
    See Depositor Comments Below
  • Promoter Tet operator (tetracycline inducible expression)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer gtaccacttcctaccctcgtaaac
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains K140R, I414T, and K1097R mutations in Cas9. These mutations are not known to affect plasmid function.

Please visit https://www.biorxiv.org/content/10.1101/2022.03.24.485641v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    DOX_SAM_CRISPR-activation-2A-GFP-AAVS1-targeting-construct was a gift from Rudolf Jaenisch (Addgene plasmid # 176836 ; http://n2t.net/addgene:176836 ; RRID:Addgene_176836)

  • For your References section:

    The nuclear receptor THRB facilitates differentiation of human PSCs into more mature hepatocytes. Ma H, de Zwaan E, Guo YE, Cejas P, Thiru P, van de Bunt M, Jeppesen JF, Syamala S, Dall'Agnese A, Abraham BJ, Fu D, Garrett-Engele C, Lee TI, Long HW, Griffith LG, Young RA, Jaenisch R. Cell Stem Cell. 2022 Apr 13. pii: S1934-5909(22)00150-3. doi: 10.1016/j.stem.2022.03.015. 10.1016/j.stem.2022.03.015 PubMed 35452598
Related items:
Commonly requested with: