pcAla17
(Plasmid
#17681)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 17681 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEVX
- Backbone size w/o insert (bp) 6400
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namec-src S17A
-
Alt namec-Src
-
Alt namesrc
-
SpeciesG. gallus (chicken)
-
MutationSer 17 changed to Ala.
-
Entrez GeneSRC (a.k.a. PP60C-SCR, SDR, c-src)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer n/a (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pcAlal7 was constructed by inserting the synthetic double-stranded DNA oligomer GATCCCAGCCAGCGCCGGCGGGCCCGGTCGGTCGCGGCCGCCCGGGA between the BamHI (codon 10) and BstNI (codon 18) sites of pcAlal2.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcAla17 was a gift from David Shalloway (Addgene plasmid # 17681 ; http://n2t.net/addgene:17681 ; RRID:Addgene_17681) -
For your References section:
Mutation of amino acids in pp60c-src that are phosphorylated by protein kinases C and A. Yaciuk P, Choi JK, Shalloway D. Mol Cell Biol. 1989 Jun . 9(6):2453-63. PubMed 2474754
Map uploaded by the depositor.