pYCTK017
(Plasmid
#176721)
-
PurposeThe plasmid is part of a GG toolkit for cell-cell communication in S. cerevisiae. This plasmid is an L0 part plasmid and contains the alpha-factor gene of Tetrapisispora phaffii (sender part).
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176721 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepYTK001
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemfalpha1Tp
-
SpeciesTetrapisispora phaffii
-
MutationCodon-optimized for expression in S. cerevisiae
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer CCTGGCCTTTTGCTGGCC
- 3′ sequencing primer CCAGTAATGACCTCAGAACTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYCTK017 was a gift from Victor Sourjik (Addgene plasmid # 176721 ; http://n2t.net/addgene:176721 ; RRID:Addgene_176721) -
For your References section:
Construction of multicellular yeast networks using the communication toolkit with variable specificity and attenuation. Krink N, Loechner AC, Anders A, Kahnt J, Rensing S, Hochberg G, Sourjik V. bioRxiv 2021 10.1101/2021.09.27.462023