pAAV-hSyn-hPOMC1-26-sbGLuc-P2A-dTomato
(Plasmid
#176704)
-
Purposeneural activity dependent release of sbGLuc from presynaptic vesicles
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176704 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4530
- Total vector size (bp) 5980
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameGaussia luciferase, slow burn
-
Alt namesbGLuc
- Promoter hSyn
-
Tag
/ Fusion Protein
- hPOMC1-26 (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site AbsI (not destroyed)
- 5′ sequencing primer ACTGAAGGCGCGCTGACGTCACT
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namedTomato
-
Insert Size (bp)702
- Promoter hSyn
-
Tag
/ Fusion Protein
- P2A (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site AbsI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer atggtgagcaagggcgag
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2021.10.29.466531 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-hPOMC1-26-sbGLuc-P2A-dTomato was a gift from Ute Hochgeschwender (Addgene plasmid # 176704 ; http://n2t.net/addgene:176704 ; RRID:Addgene_176704) -
For your References section:
Selective control of synaptically-connected circuit elements by all-optical synapses. Prakash M, Murphy J, St Laurent R, Friedman N, Crespo EL, Bjorefeldt A, Pal A, Bhagat Y, Kauer JA, Shaner NC, Lipscombe D, Moore CI, Hochgeschwender U. Commun Biol. 2022 Jan 11;5(1):33. doi: 10.1038/s42003-021-02981-7. 10.1038/s42003-021-02981-7 PubMed 35017641