Skip to main content
Addgene

pAAV-hSyn-hPOMC1-26-sbGLuc-P2A-dTomato
(Plasmid #176704)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176704 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4530
  • Total vector size (bp) 5980
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Gaussia luciferase, slow burn
  • Alt name
    sbGLuc
  • Promoter hSyn
  • Tag / Fusion Protein
    • hPOMC1-26 (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site AbsI (not destroyed)
  • 5′ sequencing primer ACTGAAGGCGCGCTGACGTCACT
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    dTomato
  • Insert Size (bp)
    702
  • Promoter hSyn
  • Tag / Fusion Protein
    • P2A (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site AbsI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer atggtgagcaagggcgag
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2021.10.29.466531 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-hPOMC1-26-sbGLuc-P2A-dTomato was a gift from Ute Hochgeschwender (Addgene plasmid # 176704 ; http://n2t.net/addgene:176704 ; RRID:Addgene_176704)
  • For your References section:

    Selective control of synaptically-connected circuit elements by all-optical synapses. Prakash M, Murphy J, St Laurent R, Friedman N, Crespo EL, Bjorefeldt A, Pal A, Bhagat Y, Kauer JA, Shaner NC, Lipscombe D, Moore CI, Hochgeschwender U. Commun Biol. 2022 Jan 11;5(1):33. doi: 10.1038/s42003-021-02981-7. 10.1038/s42003-021-02981-7 PubMed 35017641