TS-PE2-C-WPRE
(Plasmid #176650)

• Purpose: Expresses C-terminus of PE2 in mammalian cells
• Depositing Lab: Hyongbum Kim
• Publication: Jang et al Nat Biomed Eng. 2021 Aug 26. pii: 10.1038/s41551-021-00788-9. doi: 10.1038/s41551-021-00788-9.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: px601
• Backbone size w/o insert (bp): 2868
• Total vector size (bp): 6993
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: C-terminus of PE2
• Alt name: C-terminus of nickase Cas9(H840A) fused to M-MLV RT
• Species: Synthetic
• Insert Size (bp): 3189
• Promoter: None
• Tag / Fusion Protein:
  • SV40 NLS (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gataggcacctattggtctt
• 3′ sequencing primer: agcgtaaaaggagcaacatag

Gene/Insert 2

• Gene/Insert name: Artificial SA
• Alt name: Artificial splicing acceptor
• Species: Synthetic
• Insert Size (bp): 83
• Promoter: None

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: None
• 3′ sequencing primer: ttccggatctcgccgttgg

Gene/Insert 3

• Gene/Insert name: WPRE
• Species: Synthetic
• Insert Size (bp): 589
• Promoter: None

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cgaattcgagcccaagaaga
• 3′ sequencing primer: gcaccttccagggtcaagga

Gene/Insert 4

• Gene/Insert name: bGH poly(A)
• Species: Synthetic
• Insert Size (bp): 225
• Promoter: None

Cloning Information for Gene/Insert 4

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gtcttcgccttcgccctc
• 3′ sequencing primer: None

Resource Information

• Supplemental Documents:
  • TS-PE2-C-WPRE.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry