TS-PE2-N
(Plasmid #176649)

• Purpose: Expresses N-terminus of PE2 in mammalian cells
• Depositing Lab: Hyongbum Kim
• Publication: Jang et al Nat Biomed Eng. 2021 Aug 26. pii: 10.1038/s41551-021-00788-9. doi: 10.1038/s41551-021-00788-9.

Backbone

• Vector backbone: px601
• Backbone size w/o insert (bp): 3544
• Total vector size (bp): 6719
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: N-terminus of PE2
• Alt name: N-terminus of nickase Cas9(H840A)
• Species: Synthetic
• Insert Size (bp): 3126
• Promoter: CMV
• Tag / Fusion Protein:
  • SV40 NLS (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: agctctctggctaactaccg
• 3′ sequencing primer: gccgccccagtttctattg

Gene/Insert 2

• Gene/Insert name: Artificial SD
• Alt name: Artificial splicing donor
• Species: Synthetic
• Insert Size (bp): 50
• Promoter: None

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggtgtacgacgtgcggaag
• 3′ sequencing primer: gaaaataccgcatcaggcgc

Resource Information

• Supplemental Documents:
  • TS-PE2-N.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry