Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

TS-PE2-N
(Plasmid #176649)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176649 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    px601
  • Backbone size w/o insert (bp) 3544
  • Total vector size (bp) 6719
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    N-terminus of PE2
  • Alt name
    N-terminus of nickase Cas9(H840A)
  • Species
    Synthetic
  • Insert Size (bp)
    3126
  • Promoter CMV
  • Tag / Fusion Protein
    • SV40 NLS (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer agctctctggctaactaccg
  • 3′ sequencing primer gccgccccagtttctattg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Artificial SD
  • Alt name
    Artificial splicing donor
  • Species
    Synthetic
  • Insert Size (bp)
    50
  • Promoter None

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggtgtacgacgtgcggaag
  • 3′ sequencing primer gaaaataccgcatcaggcgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TS-PE2-N was a gift from Hyongbum Kim (Addgene plasmid # 176649 ; http://n2t.net/addgene:176649 ; RRID:Addgene_176649)
  • For your References section:

    Application of prime editing to the correction of mutations and phenotypes in adult mice with liver and eye diseases. Jang H, Jo DH, Cho CS, Shin JH, Seo JH, Yu G, Gopalappa R, Kim D, Cho SR, Kim JH, Kim HH. Nat Biomed Eng. 2021 Aug 26. pii: 10.1038/s41551-021-00788-9. doi: 10.1038/s41551-021-00788-9. 10.1038/s41551-021-00788-9 PubMed 34446856