pGEM-Isce-Tol2-Tn5-neo
(Plasmid
#176619)
-
Purposefor generating PCR templates with Tol2 repeats and Isce sites for BAC recombination
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176619 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGEM-T
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 4300
-
Vector typeUnspecified
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Kanamycin, 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameI-SceI sites, Tol2 repeats and Tn5-neo cassette
-
SpeciesSynthetic
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer ATTTAGGTGACACTATAGAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEM-Isce-Tol2-Tn5-neo was a gift from Nathan Lawson (Addgene plasmid # 176619 ; http://n2t.net/addgene:176619 ; RRID:Addgene_176619) -
For your References section:
Integrated molecular analysis identifies a conserved pericyte gene signature in zebrafish. Shih YH, Portman D, Idrizi F, Grosse A, Lawson ND. Development. 2021 Nov 9. pii: 273393. doi: 10.1242/dev.200189. 10.1242/dev.200189 PubMed 34751773