Skip to main content
Addgene

BL21 Rosetta2 ΔrecBCD GamS
(Bacterial strain #176586)

Full plasmid sequence is not available for this item.

No maps are available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Bacterial Strain 176586 Bacteria in agar stab 1 $85

Backbone

  • Vector backbone
    Strain
  • Modifications to backbone
    This strain is a derivative of BL21 ΔrecBCD. It was made by re-transformation with pRARE2 + pBADmod1-linker2-gamS plasmids.
  • Selectable markers
    Chloramphenicol for pRARE2 (Low Copy number)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    BL21 ΔrecBCD
  • Growth instructions
    Recommended Antibiotic Concentration: Chloramphenicol 10µg/mL, Ampicillin 50 µg/mL. For induction 0.25% w/v L-Arabinose at 30°C
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    pRARE2 + pBADmod1-linker2-gamS plasmid
  • Mutation
    recBCD genomic deletion

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint.

Primers for recBCD deletion verification:
Foward - ttgatttactgcccgagagc
Reverse - gtcaaccgaatgcagacatc

Primers for GamS plasmid verification:
Forward - aattatgacaacttgacggctacatcattc
Reverse - cgttcaccgacaaacaaca

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BL21 Rosetta2 ΔrecBCD GamS was a gift from Jean-Loup Faulon (Addgene plasmid # 176586)
  • For your References section:

    Differentially Optimized Cell-Free Buffer Enables Robust Expression from Unprotected Linear DNA in Exonuclease-Deficient Extracts. Batista AC, Levrier A, Soudier P, Voyvodic PL, Achmedov T, Reif-Trauttmansdorff T, DeVisch A, Cohen-Gonsaud M, Faulon JL, Beisel CL, Bonnet J, Kushwaha M. ACS Synth Biol. 2022 Jan 16. doi: 10.1021/acssynbio.1c00448. 10.1021/acssynbio.1c00448 PubMed 35034449