BL21 Rosetta2 ΔrecB GamS
(Bacterial strain
#176585)
-
PurposeE. coli BL21 strain (with recB genomic locus deleted) for making cell-free extracts for Linear DNA expression. Contains pRARE2 + pBADmod1-linker2-gamS plasmids.
-
Depositing Lab
-
Sequence Information
-
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Bacterial Strain | 176585 | Bacteria in agar stab | 1 | $85 |
Backbone
-
Vector backboneStrain
-
Modifications to backboneThis strain is a derivative of BL21 ΔrecB. It was made by re-transformation with pRARE2 + pBADmod1-linker2-gamS plasmids.
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)BL21 ΔrecB
-
Growth instructionsRecommended Antibiotic Concentration: Chloramphenicol 10µg/mL, Ampicillin 50 µg/mL. For induction 0.25% w/v L-Arabinose at 30°C
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepRARE2 + pBADmod1-linker2-gamS plasmid
-
MutationrecB genomic deletion
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer Unknown (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint.
Primers for recB deletion verification:
Foward - tattttccagtcgtgaaagc
Reverse - ttgctgatttcttccatcag
Primers for GamS plasmid verification:
Forward - aattatgacaacttgacggctacatcattc
Reverse - cgttcaccgacaaacaaca
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BL21 Rosetta2 ΔrecB GamS was a gift from Jean-Loup Faulon (Addgene plasmid # 176585) -
For your References section:
Differentially Optimized Cell-Free Buffer Enables Robust Expression from Unprotected Linear DNA in Exonuclease-Deficient Extracts. Batista AC, Levrier A, Soudier P, Voyvodic PL, Achmedov T, Reif-Trauttmansdorff T, DeVisch A, Cohen-Gonsaud M, Faulon JL, Beisel CL, Bonnet J, Kushwaha M. ACS Synth Biol. 2022 Jan 16. doi: 10.1021/acssynbio.1c00448. 10.1021/acssynbio.1c00448 PubMed 35034449