BL21 Rosetta2 GamS
(Bacterial strain #176584)

• Purpose: E. coli BL21 strain for making cell-free extracts for Linear DNA expression. Contains pRARE2 + pBADmod1-linker2-gamS plasmids.
• Depositing Lab: Jean-Loup Faulon
• Publication: Batista et al ACS Synth Biol. 2022 Jan 16. doi: 10.1021/acssynbio.1c00448.

Backbone

• Vector backbone: Unknown
• Modifications to backbone: This strain is a derivative of E. coli BL21. It was made by re-transformation with pRARE2 + pBADmod1-linker2-gamS plasmids.

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): BL21
• Growth instructions: Recommended Antibiotic Concentration: Chloramphenicol 10µg/mL, Ampicillin 50 µg/mL. For induction use 0.25% w/v L-Arabinose at 30°C
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: pRARE2 + pBADmod1-linker2-gamS plasmid

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: Unknown

Resource Information

• Supplemental Documents:
  • RecBCD Locus (SnapGene file with alignment)
  • GamS Plasmid (SnapGene file with alignment)
  • RecBCD Locus (annotated GenBank file)
  • GamS Plasmid (annotated GenBank file)
  • Sequencing Results
  • PCR Results

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint.

Primers for genomic verification:
Foward - tattttccagtcgtgaaagc
Reverse - ttgctgatttcttccatcag

Primers for GamS plasmid verification:
Forward - aattatgacaacttgacggctacatcattc
Reverse - cgttcaccgacaaacaaca