pET29b-mVenus-dspB(E184Q W330Y)-6xHis
(Plasmid #176577)

• Purpose: Plasmid for overexpression of recombinant His-tagged fusion protein mVenus-DspB(E184Q W330Y), used as a non-binding control for detection of biofilm polysaccharide PNAG.
• Depositing Lab: Mark Nitz
• Publication: Eddenden et al Methods Enzymol. 2022;665:209-231. doi: 10.1016/bs.mie.2021.11.006. Epub 2021 Dec 7.

Backbone

• Vector backbone: pET29b
• Backbone size w/o insert (bp): 5313
• Total vector size (bp): 7152
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Dispersin B
• Alt name: DspB
• Species: Aggregatibacter actinomycetemcomitans
• Insert Size (bp): 1839
• Mutation: E184Q W330Y
• GenBank ID: AY228551.1
• Promoter: T7
• Tags / Fusion Proteins:
  • mVenus (N terminal on insert)
  • Hexahistidine tag (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pdb19-pet29bmvenus-dspb-e184q-w330y-6xhis.gb
• A portion of this plasmid was derived from a plasmid made by: Dr. Narayanan Ramasubbu Rutgers School of Dental Medicine
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry