Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET29b-mVenus-dspB(E184Q)-6xHis
(Plasmid #176576)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176576 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET29b
  • Backbone size w/o insert (bp) 5313
  • Total vector size (bp) 7152
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Dispersin B
  • Alt name
    DspB
  • Species
    Aggregatibacter actinomycetemcomitans
  • Insert Size (bp)
    1839
  • Mutation
    E184Q
  • GenBank ID
    AY228551.1
  • Promoter T7
  • Tags / Fusion Proteins
    • mVenus (N terminal on insert)
    • Hexahistidine tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET29b-mVenus-dspB(E184Q)-6xHis was a gift from Mark Nitz (Addgene plasmid # 176576 ; http://n2t.net/addgene:176576 ; RRID:Addgene_176576)
  • For your References section:

    Applications of an inactive Dispersin B probe to monitor biofilm polysaccharide production. Eddenden A, Nitz M. Methods Enzymol. 2022;665:209-231. doi: 10.1016/bs.mie.2021.11.006. Epub 2021 Dec 7. 10.1016/bs.mie.2021.11.006 PubMed 35379435