Lac-I-SceI-Tet
(Plasmid #17655)

• Depositing Lab: Tom Misteli
• Publication: Soutoglou et al Nat Cell Biol. 2007 Jun . 9(6):675-82.

Backbone

• Vector backbone: pBluescript
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 3000
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Stbl3
• Growth instructions: 30 degrees, Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: lac I-SceI tet
• Alt name: lac operator
• Alt name: tet operator

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: T7
• 3′ sequencing primer: T3

Resource Information

• Supplemental Documents:
  • Lac-I-SceI-Tet seq from author
  • Suggested Diagnostic Digest for Lac-I-SceI-Tet
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The 256 lac operator repeats (XhoI fragment) and the 96 tet operator repeats (XhoI –SacII fragment) from the p16PCbeta
plasmid (gift from D. Spector) were cloned into pBluescript. Between the two fragments a single 18nt I-SceI site was inserted (SalI).

lac operator repeat: tggaattgtgagcggataacaatt
tet operator repeat: tccctatcagtgatagaga

This plasmid is not stable in bacteria. Every bacterial stock made will contain correct and incorrect bacteria and when bacteria are grown, you will get colonies which contain the correct plasmid and others which contain recombinant versions. If you check multiple colonies (10-20) in the samples after streaking out a stab, you should find correct ones. The recipient will need to grow the bacteria, isolate individual colonies check them, and make a prep from the correct one. We recommend processing the stab and screening colonies immediately upon receipt.