pHR pUAS-dGFP pPGK-iRFP
(Plasmid #176530)

• Purpose: Lentiviral vector expressing a UAS-driven destabilized GFP, as well as a PGK promoter-driven iRFP marker.
• Depositing Lab: Jared Toettcher
• Publication: Ravindran et al Cell Syst. 2022 Feb 16;13(2):131-142.e13. doi: 10.1016/j.cels.2021.10.002. Epub 2021 Nov 4.

Backbone

• Vector backbone: pHR
• Backbone size w/o insert (bp): 8000
• Total vector size (bp): 2500
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: dGFP
• Alt name: destabilized GFP
• Species: Synthetic
• Insert Size (bp): 846
• Promoter: UASp

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gacattcgttggatcatggtgagcaagggcgag

Gene/Insert 2

• Gene/Insert name: iRFP
• Alt name: infrared fluorescent protein
• Species: Synthetic
• Insert Size (bp): 948
• Promoter: PGKp

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cagcccaagcttaccatggctgaaggAtccgtcgcCAGGCAGCC

Resource Information

• Supplemental Documents:
  • pHR_Gal4UAS_dGFP_PGK_iRFP.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry