Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

sgCRY1
(Plasmid #176511)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176511 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-hU6-gRNA-hSyn-mCherry-KASH
  • Backbone size w/o insert (bp) 5288
  • Total vector size (bp) 5290
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    hU6-sgCRY1-2
  • Alt name
    sgCRY1
  • gRNA/shRNA sequence
    GGTCGAGGATATAGACGCAG
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Cry1 (a.k.a. Phll1)
  • Entrez Gene
    Cry2 (a.k.a. D130054K12Rik)
  • Promoter U6, hSyn
  • Tag / Fusion Protein
    • mCherry (K14E, N210D, E249G) (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (not destroyed)
  • 3′ cloning site BsaI (not destroyed)
  • 5′ sequencing primer ITR_R CGGCCTCAGTGAGCGA
  • 3′ sequencing primer hSyn_R gtcggtcgtcaggtaggcac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the mutations K14E, N210D, and E249G were found in the mCherry sequence. The fluorophore is still fluorescent, as described in the publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgCRY1 was a gift from Han Kyoung Choe (Addgene plasmid # 176511 ; http://n2t.net/addgene:176511 ; RRID:Addgene_176511)
  • For your References section:

    Multiplexed CRISPR-Cas9 system in a single adeno-associated virus to simultaneously knock out redundant clock genes. Kim B, Kim J, Chun M, Park I, Kwak D, Choi M, Kim K, Choe HK. Sci Rep. 2021 Jan 28;11(1):2575. doi: 10.1038/s41598-021-82287-0. 10.1038/s41598-021-82287-0 PubMed 33510438