PX459-APP-KO
(Plasmid
#176487)
-
PurposeTo knockout APP gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176487 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePX459
-
Vector typeCRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA sequence
-
gRNA/shRNA sequenceCACCGGCGGAATTGACAAGTTCCGA
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.03.31.486371v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX459-APP-KO was a gift from Wade Harper (Addgene plasmid # 176487 ; http://n2t.net/addgene:176487 ; RRID:Addgene_176487) -
For your References section:
Spatial snapshots of amyloid precursor protein intramembrane processing via early endosome proteomics. Park H, Hundley FV, Yu Q, Overmyer KA, Brademan DR, Serrano L, Paulo JA, Paoli JC, Swarup S, Coon JJ, Gygi SP, Wade Harper J. Nat Commun. 2022 Oct 16;13(1):6112. doi: 10.1038/s41467-022-33881-x. 10.1038/s41467-022-33881-x PubMed 36245040